Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38745 Target Info
Target Name DNA fragmentation factor alpha (DFFA)
Synonyms Inhibitor of caspase-3-activated Dnase; Inhibitor of CAD; ICAD; H13; DNA fragmentation factor subunit alpha; DNA fragmentation factor 45 kDa subunit; DFF45; DFF1; DFF-45
Target Type Literature-reported Target
Gene Name DFFA
UniProt ID
O00273
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
References  Top
REF 1 MiR-145, a new regulator of the DNA fragmentation factor-45 (DFF45)-mediated apoptotic network. Mol Cancer. 2010 Aug 6;9:211.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.