Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T38159 |
Target Info
|
| Target Name |
Trefoil factor-1 (TFF1) |
| Synonyms |
hP1.A; Trefoil factor 1; Protein pS2; Polypeptide P1.A; PS2; PNR-2; Breast cancer estrogen-inducible protein; BCEI |
| Target Type |
Clinical trial Target |
| Gene Name |
TFF1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-423-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugaggggcagagagcgagacuuu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
TFF1 is a novel target gene of miRNA-423-5p and miRNA-423-5p negatively regulated the expression of TFF1 by binding to its 3'UTR and participated in proliferation/invasion related processes via a TFF1 dependent manner in gastric cancer cells. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Trefoil factor-1 (TFF1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-504-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agacccuggucugcacucuauc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miRNA423-5p regulates cell proliferation and invasion by targeting trefoil factor 1 in gastric cancer cells. Cancer Lett. 2014 May 28;347(1):98-104.
|
| REF 2 |
miR218-5p regulates the proliferation of gastric cancer cells by targeting TFF1 in an Erk1/2-dependent manner. Biochim Biophys Acta. 2015 May;1852(5):970-9.
|
| REF 3 |
TFF1 activates p53 through down-regulation of miR-504 in gastric cancer. Oncotarget. 2014 Jul 30;5(14):5663-73.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
