Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38087 Target Info
Target Name Tankyrase-2 (TNKS-2)
Synonyms Tankyrase-related protein; Tankyrase-like protein; Tankyrase II; TRF1-interacting ankyrin-related ADP-ribose polymerase 2; TNKL; TANK2; Protein poly-ADP-ribosyltransferase tankyrase-2; Poly [ADP-ribose] polymerase tankyrase-2; Poly [ADP-ribose] polymerase 5B; PARP5B; ARTD6; ADP-ribosyltransferase diphtheria toxin-like 6
Target Type Clinical trial Target
Gene Name TNKS2
Biochemical Class Glycosyltransferases
UniProt ID
Q9H2K2
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-490-3p miRNA Info
miRNA Mature AC
MIMAT0002806
Sequence caaccuggaggacuccaugcug
miRNA Species Homo sapiens
Regulation Mechanism 490-3p interferes with activation of B-catenin signaling in breast cancer cells by targeting TNKS2 [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
References  Top
REF 1 miR-490-3p inhibits the growth and invasiveness in triple-negative breast cancer by repressing the expression of TNKS2. Gene. 2016 Nov 15;593(1):41-47.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.