Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T37539 |
Target Info
|
| Target Name |
B-cell receptor CD22 (CD22) |
| Synonyms |
T-cell surface antigen Leu-14; Siglec-2; Sialic acid-binding Ig-like lectin 2; SIGLEC2; Leu-14; BL-CAM; B-lymphocyte cell adhesion molecule |
| Target Type |
Successful Target |
| Gene Name |
CD22 |
| Biochemical Class |
Immunoglobulin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugugcaaaucuaugcaaaacuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CD22 was a direct target of miR-19. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR |
[1] |
| 2 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-19a and CD22 Comprise a Feedback Loop for B Cell Response in Sepsis. Med Sci Monit. 2015 May 28;21:1548-55.
|
| REF 2 |
The Myc-miR-17-92 axis amplifies B-cell receptor signaling via inhibition of ITIM proteins: a novel lymphomagenic feed-forward loop. Blood. 2013 Dec 19;122(26):4220-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
