Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35565 Target Info
Target Name Alkaline phosphatase (ALPPL2)
Synonyms Placental alkaline phosphatase-like; PLAP-like; Germ cell alkaline phosphatase; GCAP; Alkaline phosphatase, placental-like; Alkaline phosphatase, germ cell type; Alkaline phosphatase Nagao isozyme; ALPPL; ALPG; ALP-1
Target Type Literature-reported Target
Gene Name ALPPL2
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P10696
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
References  Top
REF 1 miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.