Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35265 Target Info
Target Name S100 calcium-binding protein A4 (S100A4)
Synonyms Protein S100-A4; Protein Mts1; Placental calcium-binding protein; Metastasin; MTS1; Calvasculin; CAPL
Target Type Literature-reported Target
Gene Name S100A4
Biochemical Class S100 calcium-binding protein
UniProt ID
P26447
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-187-3p miRNA Info
miRNA Mature AC
MIMAT0000262
Sequence ucgugucuuguguugcagccgg
miRNA Species Homo sapiens
Regulation Mechanism miR-187-3p inhibits the metastasis and EMT in HCC by targeting S100A4. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA B7 homolog 3 (CD276) Target Info
CD276_HUMAN
S100 calcium-binding protein A4 (S100A4) Target Info
S10A4_HUMAN
References  Top
REF 1 miR-187-3p inhibits the metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by targeting S100A4. Cancer Lett. 2016 Oct 28;381(2):380-90.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.