Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35232 Target Info
Target Name Interleukin-7 (IL7)
Synonyms Interleukin7; IL-7
Target Type Clinical trial Target
Gene Name IL7
Biochemical Class Cytokine: interleukin
UniProt ID
P13232
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism miR-181c was able to negatively regulate the production of proinflammatory cytokines IL-17 in MG patients. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
References  Top
REF 1 Decreased microRNA miR-181c expression in peripheral blood mononuclear cells correlates with elevated serum levels of IL-7 and IL-17 in patients with myasthenia gravis. Clin Exp Med. 2016 Aug;16(3):413-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.