Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T34562 Target Info
Target Name Serum paraoxonase/arylesterase 1 (PON1)
Synonyms Serum paraoxonase; Serum aryldialkylphosphatase 1; Serum aryldiakylphosphatase 1; PON 1; PON; K-45; Aromatic esterase 1; A-esterase 1
Target Type Literature-reported Target
Gene Name PON1
Biochemical Class Carboxylic ester hydrolase
UniProt ID
P27169
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-616-3p miRNA Info
miRNA Mature AC
MIMAT0004805
Sequence agucauuggaggguuugagcag
miRNA Species Homo sapiens
Regulation Mechanism miR-616 binding to the PON1 3'UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Serum paraoxonase/arylesterase 1 (PON1) Target Info
PON1_HUMAN
References  Top
REF 1 A functional polymorphism of PON1 interferes with microRNA binding to increase the risk of ischemic stroke and carotid atherosclerosis. Atherosclerosis. 2013 May;228(1):161-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.