miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-616-3p | ||||
| miRNA Stemloop AC | MI0003629 | ||||
| miRNA Stemloop ID | hsa-mir-616 | ||||
| Sequence | agucauuggaggguuugagcag | ||||
| TTD Target(s) Regulated by This miRNA | Serum paraoxonase/arylesterase 1 (PON1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Tissue factor pathway inhibitor 2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | A functional polymorphism of PON1 interferes with microRNA binding to increase the risk of ischemic stroke and carotid atherosclerosis. Atherosclerosis. 2013 May;228(1):161-7. | ||||
| REF 2 | MicroRNA-616 induces androgen-independent growth of prostate cancer cells by suppressing expression of tissue factor pathway inhibitor TFPI-2.Cancer Res. 2011 Jan 15;71(2):583-92. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.