Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T33969 Target Info
Target Name ATP-binding cassette transporter B11 (ABCB11)
Synonyms BSEP; ATP-binding cassette, sub-family B, member 11; ATP-binding cassette sub-family B member 11
Target Type Literature-reported Target
Gene Name ABCB11
Biochemical Class ABC transporter
UniProt ID
O95342
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism ABCB11 are direct targets of miR-33. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
References  Top
REF 1 miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity. EMBO Mol Med. 2012 Sep;4(9):882-95.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.