Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T32973 |
Target Info
|
| Target Name |
Legumain (LGMN) |
| Synonyms |
Protease, cysteine 1; PRSC1; Asparaginyl endopeptidase |
| Target Type |
Clinical trial Target |
| Gene Name |
LGMN |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-3978 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guggaaagcaugcauccagggugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Loss of miR-3978 leads to increased expression of legumain (LGMN), which indicates that miR-3978 might be a biomarker for peritoneal metastasis in patients with gastric cancer. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Legumain (LGMN)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiRNA-3978 regulates peritoneal gastric cancer metastasis by targeting legumain. Oncotarget. 2016 Dec 13;7(50):83223-83230.
|
| REF 2 |
Expression of both poly r(C) binding protein 1 (PCBP1) and miRNA-3978 is suppressed in peritoneal gastric cancer metastasis. Sci Rep. 2017 Nov 14;7(1):15488.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
