miRNA General Information
miRNA Mature ID	hsa-miR-3978
miRNA Stemloop AC	MI0016996
miRNA Stemloop ID	hsa-mir-3978
Sequence	guggaaagcaugcauccagggugu
TTD Target(s) Regulated by This miRNA	Legumain (LGMN)	Clinical trial Target	Target Info	[1]
References
REF 1	MiRNA-3978 regulates peritoneal gastric cancer metastasis by targeting legumain. Oncotarget. 2016 Dec 13;7(50):83223-83230.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.