Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T32855 |
Target Info
|
| Target Name |
Neurotrophin-3 (NTF3) |
| Synonyms |
Neurotrophic factor; Nerve growth factor 2; NT-3; NGF-2; HDNF |
| Target Type |
Discontinued Target |
| Gene Name |
NTF3 |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaauacugccggguaaugaugga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
NTF3 is a Direct Target of miR-200c. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Neurotrophin-3 mRNA a putative target of miR21 following status epilepticus. Brain Res. 2011 Nov 18;1424:53-9.
|
| REF 2 |
Up-regulation of microRNAs, miR21 and miR23a in human liver cancer cells treated with Coptidis rhizoma aqueous extract. Exp Ther Med. 2011 Jan;2(1):27-32.
|
| REF 3 |
miR-200c targets a NF-B up-regulated TrkB/NTF3 autocrine signaling loop to enhance anoikis sensitivity in triple negative breast cancer. PLoS One. 2012;7(11):e49987.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
