Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T32600 Target Info
Target Name Fos-related antigen 2 (FOSL2)
Synonyms FRA2; FRA-2
Target Type Literature-reported Target
Gene Name FOSL2
Biochemical Class Basic leucine zipper bZIP
UniProt ID
P15408
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-590-3p miRNA Info
miRNA Mature AC
MIMAT0004801
Sequence uaauuuuauguauaagcuagu
miRNA Species Homo sapiens
Regulation Mechanism FOSL2 was a direct target of miR-597 with a binding site at the 3'UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Fos-related antigen 2 (FOSL2) Target Info
FOSL2_HUMAN
Zinc finger E-box-binding homeobox 2 (ZEB2) Target Info
ZEB2_HUMAN
References  Top
REF 1 miR-597 inhibits breast cancer cell proliferation, migration and invasion through FOSL2. Oncol Rep. 2017 May;37(5):2672-2678.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.