miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-590-3p | ||||
| miRNA Stemloop AC | MI0003602 | ||||
| miRNA Stemloop ID | hsa-mir-590 | ||||
| Sequence | uaauuuuauguauaagcuagu | ||||
| TTD Target(s) Regulated by This miRNA | Fos-related antigen 2 (FOSL2) | Literature-reported Target | Target Info | [1] | |
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Adenomatous polyposis coli protein | Regulated Protein | [3] | ||
| Metastasis-associated in colon cancer protein 1 | Regulated Protein | [4] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | miR-597 inhibits breast cancer cell proliferation, migration and invasion through FOSL2. Oncol Rep. 2017 May;37(5):2672-2678. | ||||
| REF 2 | miR-590-3p suppresses cancer cell migration, invasion and epithelial-mesenchymal transition in glioblastoma multiforme by targeting ZEB1 and ZEB2. Biochem Biophys Res Commun. 2015 Dec 25;468(4):739-45. | ||||
| REF 3 | MiR-590-3p regulates osteogenic differentiation of human mesenchymal stem cells by regulating APC gene.Biochem Biophys Res Commun. 2016 Sep 30;478(4):1582-7. | ||||
| REF 4 | Combination of Endothelial-Monocyte-Activating Polypeptide-II with Temozolomide Suppress Malignant Biological Behaviors of Human Glioblastoma Stem Cells via miR-590-3p/MACC1 Inhibiting PI3K/AKT/mTOR Signal Pathway.Front Mol Neurosci. 2017 Mar 13;10:68. | ||||
| REF 5 | miR-590-3p suppresses cancer cell migration, invasion and epithelial-mesenchymal transition in glioblastoma multiforme by targeting ZEB1 and ZEB2. Biochem Biophys Res Commun. 2015 Dec 25;468(4):739-45. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.