Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T32247 Target Info
Target Name Calcitonin receptor (CALCR)
Synonyms CT-R
Target Type Successful Target
Gene Name CALCR
Biochemical Class GPCR secretin
UniProt ID
P30988
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29 targets RNAs associated with the macrophage lineage: CALCR (calcitonin receptor), which regulates osteoclast survival and resorption, is a novel miR-29 target. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. J Biol Chem. 2013 Nov 15;288(46):33347-60.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.