Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T31543 Target Info
Target Name Suppressor of tumorigenicity 14 protein (ST14)
Synonyms Tumor-associated differentially-expressed gene 15 protein; Tumor associated differentially-expressed gene-15 protein; TADG15; Serine protease TADG-15; Serine protease 14; SNC19; Prostamin; PRSS14; Membrane-type serine protease 1; Membrane type serine protease 1; Matriptase; MT-SP1
Target Type Patented-recorded Target
Gene Name ST14
Biochemical Class Peptidase
UniProt ID
Q9Y5Y6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-27b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ST14. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [1]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
References  Top
REF 1 ST14 (suppression of tumorigenicity 14) gene is a target for miR-27b, and the inhibitory effect of ST14 on cell growth is independent of miR-27b regulation. J Biol Chem. 2009 Aug 21;284(34):23094-106.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.