Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T30790 |
Target Info
|
| Target Name |
Calcium-release activated calcium channel (CRACM) |
| Synonyms |
Transmembrane protein 142A; TMEM142A; Protein orai-1; Calcium release-activated calcium channel protein 1; CRACM1 |
| Target Type |
Clinical trial Target |
| Gene Name |
ORAI1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-519d-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaagugccucccuuuagagug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The Akt/GSK3b pathway contributed to ORAI1 effects in CRC cells, and ORAI1 was a direct target of miR-519. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Calcium-release activated calcium channel (CRACM)
|
Target Info
|
|
|
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Growth inhibition by miR-519 via multiple p21-inducing pathways. Mol Cell Biol. 2012 Jul;32(13):2530-48.
|
| REF 2 |
Orai1, a Direct Target of microRNA-519, Promotes Progression of Colorectal Cancer via Akt/GSK3 Signaling Pathway. Dig Dis Sci. 2016 Jun;61(6):1553-60.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
