Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T30420 | Target Info | |||
| Target Name | SET domain containing 8 (KMT5A) | ||||
| Synonyms | SETD8; SET8; SET07; SET domain-containing protein 8; PRSET7; PR/SET07; PR/SET domain-containing protein 07; PR-Set7; N-lysine methyltransferase KMT5A; Lysine-specific methylase 5A; Lysine N-methyltransferase 5A; Histone-lysine N-methyltransferase KMT5A; H4-K20-HMTase KMT5A | ||||
| Target Type | Preclinical Target | ||||
| Gene Name | KMT5A | ||||
| Biochemical Class | Methyltransferase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-127-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucggauccgucugagcuuggcu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | The inhibitory effect of miR-127-3p on SETD8 involved binding to the 3'UTR in the MG63. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Matrix metalloproteinase-13 (MMP-13) | Target Info | |||
| O-6-methylguanine-DNA-alkyltransferase (MGMT) | Target Info | ||||
| miRNA Mature ID | hsa-miR-502-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | auccuugcuaucugggugcua | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| 2 | Luciferase Reporter Assay | [4] | |||
| Representative Target(s) Regulated by This miRNA | Interferon regulatory factor 1 (IRF1) | Target Info | |||
| SET domain containing 8 (KMT5A) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Down-regulation of MiR-127 facilitates hepatocyte proliferation during rat liver regeneration. PLoS One. 2012;7(6):e39151. | ||||
| REF 2 | MicroRNA-127-3p inhibits proliferation and invasion by targeting SETD8 in human osteosarcoma cells. Biochem Biophys Res Commun. 2016 Jan 22;469(4):1006-11. | ||||
| REF 3 | An miR-502-binding site single-nucleotide polymorphism in the 3'-untranslated region of the SET8 gene is associated with early age of breast cancer... Clin Cancer Res. 2009 Oct 1;15(19):6292-300. | ||||
| REF 4 | Genetic variation in a microRNA-502 minding site in SET8 gene confers clinical outcome of non-small cell lung cancer in a Chinese population. PLoS One. 2013 Oct 11;8(10):e77024. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.