Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T29736 |
Target Info
|
Target Name |
Laminin beta-3 chain (LAMB3) |
Synonyms |
Nicein subunit beta; Laminin5beta3; Laminin-5 subunit beta; Laminin subunit beta-3; Laminin B1k chain; Laminin 5 beta 3; LAMNB1; Kalinin subunit beta; Kalinin B1 chain; Epiligrin subunit bata |
Target Type |
Clinical trial Target |
Gene Name |
LAMB3 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-218-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uugugcuugaucuaaccaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-218-5p by mature miRNA precursor transfection resulted in the changed mRNA level of target LAMB3. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Literature Reported |
[1] |
2 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Laminin beta-3 chain (LAMB3)
|
Target Info
|
|
Transcription factor Sp1 (SP1)
|
Target Info
|
|
References |
Top |
REF 1 |
Polymorphisms involved in the miR-218-LAMB3 pathway and susceptibility of cervical cancer, a case-control study in Chinese women. Gynecol Oncol. 2010 May;117(2):287-90.
|
REF 2 |
Human papillomavirus type 16 reduces the expression of microRNA-218 in cervical carcinoma cells. Oncogene. 2008 Apr 17;27(18):2575-82.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.