Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T23984 |
Target Info
|
| Target Name |
Bromodomain-containing protein 7 (BRD7) |
| Synonyms |
Protein CELTIX-1; CELTIX1; BP75; 75 kDa bromodomain protein |
| Target Type |
Literature-reported Target |
| Gene Name |
BRD7 |
| Biochemical Class |
Bromodomain |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-300 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uauacaagggcagacucucucu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Bromodomain-containing protein 7 (BRD7)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaauacugccggguaaugaugga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-200c decreases the expression of BRD7. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Up-Regulation of MiR-300 Promotes Proliferation and Invasion of Osteosarcoma by Targeting BRD7. PLoS One. 2015 May 26;10(5):e0127682.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
| REF 3 |
The interactions between MicroRNA-200c and BRD7 in endometrial carcinoma. Gynecol Oncol. 2012 Jan;124(1):125-33.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
