Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22978 Target Info
Target Name Transforming growth factor beta 3 (TGFB3)
Synonyms Transforming growth factor beta-3 proprotein; Transforming growth factor beta-3; TGF-beta-3; Latency-associated peptide
Target Type Clinical trial Target
Gene Name TGFB3
Biochemical Class Growth factor
UniProt ID
P10600
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29 targets TGFB3 and TGFB3 was significantly upregulated in DM1 patients. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.