Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22956 Target Info
Target Name Cyclin-dependent kinase 3 (CDK3)
Synonyms Cyclindependent kinase 3; Cell division protein kinase 3; CDKN3
Target Type Clinical trial Target
Gene Name CDK3
Biochemical Class Kinase
UniProt ID
Q00526
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-873-5p miRNA Info
miRNA Mature AC
MIMAT0004953
Sequence gcaggaacuugugagucuccu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-873 resulted in a clear reduction in CDK3 protein levels in MCF-7 and T47D cells. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Immunohistochemistry; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
Multidrug resistance protein 1 (ABCB1) Target Info
MDR1_HUMAN
miRNA Mature ID hsa-miR-214-5p miRNA Info
miRNA Mature AC
MIMAT0004564
Sequence ugccugucuacacuugcugugc
miRNA Species Homo sapiens
Regulation Mechanism miR-214 directly inhibited CDK3 cell-cycle regulators. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
References  Top
REF 1 HuR facilitates cancer stemness of lung cancer cells via regulating miR-873/CDK3 and miR-125a-3p/CDK3 axis. Biotechnol Lett. 2018 Apr;40(4):623-631.
REF 2 MiR-873 regulates ER transcriptional activity and tamoxifen resistance via targeting CDK3 in breast cancer cells. Oncogene. 2015 Jul 23;34(30):3895-907.
REF 3 miR-214/199a/199a* cluster levels predict poor survival in hepatocellular carcinoma through interference with cell-cycle regulators. Oncotarget. 2016 Jan 5;7(1):929-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.