Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22717 Target Info
Target Name Divalent metal transporter 1 (SLC11A2)
Synonyms Solute carrier family 11 member 2; OK/SW-cl.20; Natural resistanceassociated macrophage protein 2; Natural resistance-associated macrophage protein 2; NRAMP2; NRAMP 2; Divalent cation transporter 1; DMT1; DMT-1; DCT1
Target Type Literature-reported Target
Gene Name SLC11A2
Biochemical Class Natural resistance-associated macrophage protein
UniProt ID
P49281
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7d-5p miRNA Info
miRNA Mature AC
MIMAT0000065
Sequence agagguaguagguugcauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Divalent metal transporter 1 (SLC11A2) Target Info
NRAM2_HUMAN
References  Top
REF 1 Regulation of divalent metal transporter 1 (DMT1) non-IRE isoform by the microRNA Let-7d in erythroid cells. Haematologica. 2010 Aug;95(8):1244-52.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.