Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21653 Target Info
Target Name Omphalocele kinase 1 (NUAK1)
Synonyms OMPHK1; NUAK family SNF1-like kinase 1; KIAA0537; ARK5; AMPK-related protein kinase 5
Target Type Literature-reported Target
Gene Name NUAK1
Biochemical Class Kinase
UniProt ID
O60285
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism NUAK1 is a direct target of miR-211. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
References  Top
REF 1 Transcription factor/microRNA axis blocks melanoma invasion program by miR-211 targeting NUAK1. J Invest Dermatol. 2014 Feb;134(2):441-451.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.