Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17345 Target Info
Target Name Dihydrofolate reductase (DHFR)
Synonyms DYR; DHFRP1
Target Type Successful Target
Gene Name DHFR
Biochemical Class CH-NH donor oxidoreductase
UniProt ID
P00374
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-192-5p by mature miRNA precursor transfection resulted in the decreased protein level of target DHFR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-215-5p miRNA Info
miRNA Mature AC
MIMAT0000272
Sequence augaccuaugaauugacagac
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-215-5p resulted in the decreased protein level of target DHFR. [2]
Evidence Score (E-score) 2 +
1 Western Blot; Luciferase Reporter Assay [3]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-24-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target DHFR. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p binding sites in the 3'UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30.
REF 2 A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance. Proc Natl Acad Sci U S A. 2007 Aug 14;104(33):13513-8.
REF 3 Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96.
REF 4 A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer. J Biol Chem. 2017 Mar 24;292(12):4873-4884.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.