Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17143 Target Info
Target Name ERK activator kinase 5 (MAP2K5)
Synonyms PRKMK5; Mitogen-activatedprotein kinase kinase 5; MKK5; MEK5; MEK 5; MAPKK 5; MAPK/ERK kinase 5; MAP kinase kinase5; MAP kinase kinase 5; Dual specificity mitogen-activated protein kinase kinase 5
Target Type Literature-reported Target
Gene Name MAP2K5
Biochemical Class Kinase
UniProt ID
Q13163
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
References  Top
REF 1 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.