Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T15438 |
Target Info
|
Target Name |
Junctional adhesion molecule A (F11R) |
Synonyms |
Platelet adhesion molecule 1; Platelet F11 receptor; PAM-1; Junctional adhesion molecule 1; JCAM; JAM1; JAM-A; JAM-1; CD321 |
Target Type |
Literature-reported Target |
Gene Name |
F11R |
Biochemical Class |
Immunoglobulin |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Reporter Assay |
[1] |
2 |
Reporter Assay; Microarray |
[2] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
References |
Top |
REF 1 |
miR-145-dependent targeting of junctional adhesion molecule A and modulation of fascin expression are associated with reduced breast cancer cell motility and invasiveness. Oncogene. 2010 Dec 16;29(50):6569-80.
|
REF 2 |
miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.