Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T13057 | Target Info | |||
| Target Name | Protein-tyrosine phosphatase SHP-2 (PTPN11) | ||||
| Synonyms | Tyrosine-protein phosphatase non-receptor type 11; SHPTP2; SHP2; SHP-2; SH-PTP3; SH-PTP2; Protein-tyrosine phosphatase SHP2; Protein-tyrosine phosphatase 2C; Protein-tyrosine phosphatase 1D; PTP2C; PTP-2C; PTP-1D | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | PTPN11 | ||||
| Biochemical Class | Phosphoric monoester hydrolase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-489-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gugacaucacauauacggcagc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-489 negatively regulates PTPN11 expression. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Matrix metalloproteinase-7 (MMP-7) | Target Info | |||
| Protein-tyrosine phosphatase SHP-2 (PTPN11) | Target Info | ||||
| miRNA Mature ID | hsa-miR-23a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aucacauugccagggauuucc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | SHP2 is a direct target of miR-23a in erythroid cells. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
| DNA topoisomerase I (TOP1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | A novel double-negative feedback loop between miR-489 and the HER2-SHP2-MAPK signaling axis regulates breast cancer cell proliferation and tumor growth. Oncotarget. 2016 Apr 5;7(14):18295-308. | ||||
| REF 2 | miR-489 is a tumour-suppressive miRNA target PTPN11 in hypopharyngeal squamous cell carcinoma (HSCC). Br J Cancer. 2010 Sep 7;103(6):877-84. | ||||
| REF 3 | A comprehensive analysis of GATA-1-regulated miRNAs reveals miR-23a to be a positive modulator of erythropoiesis. Nucleic Acids Res. 2013 Apr;41(7):4129-43. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.