miRNA General Information
miRNA Mature ID	hsa-miR-489-3p
miRNA Stemloop AC	MI0003124
miRNA Stemloop ID	hsa-mir-489
Sequence	gugacaucacauauacggcagc
TTD Target(s) Regulated by This miRNA	Matrix metalloproteinase-7 (MMP-7)	Successful Target	Target Info	[1]
	Protein-tyrosine phosphatase SHP-2 (PTPN11)	Clinical trial Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Genetic suppressor element 1	Regulated Protein	GSE1_HUMAN	[3]
	Paired box protein Pax-3	Regulated Protein	PAX3_HUMAN	[4]
	Prospero homeobox protein 1	Regulated Protein	PROX1_HUMAN	[5]
	Spindlin-1	Regulated Protein	SPIN1_HUMAN	[6]
	Zinc finger protein SNAI2	Regulated Protein	SNAI2_HUMAN	[7]
References
REF 1	microRNA-489 Plays an Anti-Metastatic Role in Human Hepatocellular Carcinoma by Targeting Matrix Metalloproteinase-7. Transl Oncol. 2017 Apr;10(2):211-220.
REF 2	miR-489 is a tumour-suppressive miRNA target PTPN11 in hypopharyngeal squamous cell carcinoma (HSCC). Br J Cancer. 2010 Sep 7;103(6):877-84.
REF 3	GSE1 negative regulation by miR-489-5p promotes breast cancer cell proliferation and invasion.Biochem Biophys Res Commun. 2016 Feb 26;471(1):123-8.
REF 4	Loss of MicroRNA-489-3p promotes osteosarcoma metastasis by activating PAX3-MET pathway.Mol Carcinog. 2017 Apr;56(4):1312-1321.
REF 5	miR-489 acts as a tumor suppressor in human gastric cancer by targeting PROX1. Am J Cancer Res. 2016 Sep 1;6(9):2021-2030.
REF 6	Suppression of SPIN1-mediated PI3K-Akt pathway by miR-489 increases chemosensitivity in breast cancer.J Pathol. 2016 Aug;239(4):459-72.
REF 7	MicroRNA-30a increases tight junction protein expression to suppress the epithelial-mesenchymal transition and metastasis by targeting Slug in breast cancer.Oncotarget. 2016 Mar 29;7(13):16462-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.