Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13017 Target Info
Target Name Syndecan-1 (SDC1)
Synonyms SYND1; SDC; CD138
Target Type Clinical trial Target
Gene Name SDC1
Biochemical Class Peptide translocating syndecan
UniProt ID
P18827
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism Syndecan-1 is a regulatory target of microRNA miR-10b in 12Z endometriotic cells and primary eutopic endometrial stroma cells. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism miR-302a directly inhibits expression of SDC1 via its 3'UTR. Overexpression of miR-302a enhanced miR-302a binding to its target gene SDC1 mRNA 3'UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of SDC1 mRNA is a direct target of miR-494. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Targeting of syndecan-1 by micro-ribonucleic acid miR-10b modulates invasiveness of endometriotic cells via dysregulation of the proteolytic milieu and interleukin-6 secretion. Fertil Steril. 2013 Mar 1;99(3):871-881.e1.
REF 2 Targeting of syndecan-1 by microRNA miR-10b promotes breast cancer cell motility and invasiveness via a Rho-GTPase- and E-cadherin-dependent mechanism. Int J Cancer. 2012 Sep 15;131(6):E884-96.
REF 3 MicroRNA-143 targets Syndecan-1 to repress cell growth in melanoma. PLoS One. 2014 Apr 10;9(4):e94855.
REF 4 MiR-302a inhibits the tumorigenicity of ovarian cancer cells by suppression of SDC1. Int J Clin Exp Pathol. 2015 May 1;8(5):4869-80.
REF 5 Irradiation-induced angiogenesis is associated with an MMP-9-miR-494-syndecan-1 regulatory loop in medulloblastoma cells. Oncogene. 2014 Apr 10;33(15):1922-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.