Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T12817 Target Info
Target Name Lipopolysaccharide-associated protein 1 (HSPA8)
Synonyms LPS-associated protein 1; LAP-1; Heat shock protein 73; Heat shock cognate 71 kDa protein; Heat shock 70 kDa protein 8; HSPA10; HSP73; HSC70
Target Type Literature-reported Target
Gene Name HSPA8
Biochemical Class Heat shock protein
UniProt ID
P11142
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [1]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
References  Top
REF 1 Downregulation of miR-33a-5p in Hepatocellular Carcinoma: A Possible Mechanism for Chemotherapy Resistance. Med Sci Monit. 2017 Mar 14;23:1295-1304.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.