Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T11561 Target Info
Target Name ETS-domain transcription factor ERF (ERF)
Synonyms Transcription factor Ets2; PE-2; Ets2 repressor factor; ETS domain-containing transcription factor ERF
Target Type Literature-reported Target
Gene Name ERF
Biochemical Class E26 transformation-specific ETS
UniProt ID
P50548
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target ERF. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLoS Comput Biol. 2010 Apr 1;6(4):e1000730.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.