Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T10864 |
Target Info
|
Target Name |
Super conserved receptor brain 2 (GPR85) |
Synonyms |
Super conserved receptor expressed in brain 2; SREB2; Probable Gprotein coupled receptor 85; Probable G-protein coupled receptor 85 |
Target Type |
Literature-reported Target |
Gene Name |
GPR85 |
Biochemical Class |
GPCR rhodopsin |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-29 targets RNAs associated with the macrophage lineage: GPG85 (G protein-coupled receptor 85), which regulates osteoclast survival and resorption, is a novel miR-29 target. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
References |
Top |
REF 1 |
miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. J Biol Chem. 2013 Nov 15;288(46):33347-60.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.