Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10125 Target Info
Target Name Dickkopf-related protein 2 (DKK2)
Synonyms hDkk2; hDkk-2; UNQ682/PRO1316; Dkk2; Dkk-2; Dickkopfrelated protein 2; Dickkopf2; Dickkopf-2
Target Type Literature-reported Target
Gene Name DKK2
Biochemical Class Dickkopf protein
UniProt ID
Q9UBU2
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism DKK2 is a Direct Target of miR-221 and miR-221 Induced Chemoresistance is Mediated Through the Wnt/b-catenin Signaling. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-1260b miRNA Info
miRNA Mature AC
MIMAT0015041
Sequence aucccaccacugccaccau
miRNA Species Homo sapiens
Regulation Mechanism The 3'UTR luciferase activity of Dkk2 was significantly decreased and protein expression significantly upregulated in miR-1260b inhibitor-transfected renal cancer cells. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 2 (DKK2) Target Info
DKK2_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism Dickkopf-2 gene (DKK2) was a direct target of miR-222 by target prediction analysis and dual luciferase reporter assay. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism DKK2 is a direct target of miR-27a. miR-27a is a negative regulator of the DKK2 gene. miR-27a dramatically suppressed endogenous DKK2 expression. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 miR-221 Mediates Chemoresistance of Esophageal Adenocarcinoma by Direct Targeting of DKK2 Expression. Ann Surg. 2016 Nov;264(5):804-814.
REF 2 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 3 Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells. Br J Cancer. 2013 May 28;108(10):2070-8.
REF 4 MicroRNA-222 promotes tumorigenesis via targeting DKK2 and activating the Wnt/-catenin signaling pathway. FEBS Lett. 2013 Jun 19;587(12):1742-8.
REF 5 The transcription factor ccaat/enhancer binding protein (C/EBP) and miR-27a regulate the expression of porcine Dickkopf2 (DKK2). Sci Rep. 2015 Dec 11;5:17972.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.