Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T09423 | Target Info | |||
| Target Name | Inward rectifier potassium channel Kir1.2 (KCNJ10) | ||||
| Synonyms | Potassiumchannel, inwardly rectifying, subfamily J, member 10; Potassium channel, inwardly rectifying subfamily J member 10; Inward rectifier K+ channel Kir1.2; Inward rectifier K(+) channel Kir1.2; ATP-sensitive inward rectifier potassium channel 10; ATP-dependent inwardly rectifying potassium channel Kir4.1; ATP dependent K+ channel | ||||
| Target Type | Successful Target | ||||
| Gene Name | KCNJ10 | ||||
| Biochemical Class | Inward rectifier potassium channel | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-205-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uccuucauuccaccggagucug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | KCNJ10 is the one of the targets of miR-205. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | The Role of MicroRNAs in the Regulation of K(+) Channels in Epithelial Tissue. Front Physiol. 2015 Dec 1;6:352. | ||||
| REF 2 | Inhibition of miR-205 impairs the wound-healing process in human corneal epithelial cells by targeting KIR4.1 (KCNJ10). Invest Ophthalmol Vis Sci. 2013 Sep 11;54(9):6167-78. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.