Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T09128 | Target Info | |||
| Target Name | Caspase-2 (CASP2) | ||||
| Synonyms | Protease ICH1; Protease ICH-1; Neural precursor cell expressed developmentally downregulated protein 2; Neural precursor cell expressed developmentally down-regulated protein 2; NEDD2; NEDD-2; ICH1; Caspase2 subunit p12; CASP-2 | ||||
| Target Type | Patented-recorded Target | ||||
| Gene Name | CASP2 | ||||
| Biochemical Class | Peptidase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-125a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucccugagacccuuuaaccuguga | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Dual Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator BAK (BAK) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-708-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aaggagcuuacaaucuagcuggg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Caspase-2 is a direct target of miR-708. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Aging and calorie restriction regulate the expression of miR-125a-5p and its target genes Stat3, Casp2 and Stard13. Aging (Albany NY). 2017 Jul 31;9(7):1825-1843. | ||||
| REF 2 | MiR-125a-5p decreases after long non-coding RNA HOTAIR knockdown to promote cancer cell apoptosis by releasing caspase 2. Cell Death Dis. 2016 Mar 10;7:e2137. | ||||
| REF 3 | miR-708 promotes the development of bladder carcinoma via direct repression of Caspase-2. J Cancer Res Clin Oncol. 2013 Jul;139(7):1189-98. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.