Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T08014 |
Target Info
|
Target Name |
TAR DNA binding protein 43 (TARDBP) |
Synonyms |
TDP43; TDP-43; TAR DNA-binding protein 43 |
Target Type |
Clinical trial Target |
Gene Name |
TARDBP |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-8485 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cacacacacacacacacguau
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-8485 represses NRXN1 expression by binding to TARDBP. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
EMSA |
[1] |
Representative Target(s) Regulated by This miRNA |
TAR DNA binding protein 43 (TARDBP)
|
Target Info
|
|
References |
Top |
REF 1 |
Transcriptome-wide analysis of TDP-43 binding small RNAs identifies miR-NID1 (miR-8485), a novel miRNA that represses NRXN1 expression. Genomics. 2014 Jan;103(1):76-82.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.