Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07930 Target Info
Target Name Histone deacetylase 5 (HDAC5)
Synonyms KIAA0600; HD5; Antigen NY-CO-9
Target Type Patented-recorded Target
Gene Name HDAC5
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q9UQL6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism HDAC5 levels are controlled by miR-125a-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-675-5p miRNA Info
miRNA Mature AC
MIMAT0004284
Sequence uggugcggagagggcccacagug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA G-protein coupled receptor 55 (GPR55) Target Info
GPR55_HUMAN
Histone deacetylase 4 (HDAC4) Target Info
HDAC4_HUMAN
References  Top
REF 1 HDAC inhibitors target HDAC5, upregulate microRNA-125a-5p, and induce apoptosis in breast cancer cells. Mol Ther. 2015 Apr;23(4):656-66.
REF 2 Long Non-coding RNA H19 Inhibits Adipocyte Differentiation of Bone Marrow Mesenchymal Stem Cells through Epigenetic Modulation of Histone Deacetylases. Sci Rep. 2016 Jun 28;6:28897.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.