Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07775 Target Info
Target Name Sodium calcium exchanger 1 (SLC8A1)
Synonyms Solute carrier family 8 member 1; Sodium/calcium exchanger 1; Na(+)/Ca(2+)-exchange protein 1; NCX1; CNC
Target Type Literature-reported Target
Gene Name SLC8A1
Biochemical Class Calcium:cation antiporter
UniProt ID
P32418
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
References  Top
REF 1 miR-185 plays an anti-hypertrophic role in the heart via multiple targets in the calcium-signaling pathways. PLoS One. 2015 Mar 13;10(3):e0122509.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.