Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T05089 |
Target Info
|
| Target Name |
Calcium-dependent chloride channel anoctamin (ANO) |
| Synonyms |
Tumoramplified and overexpressed sequence 2; Tumor-amplified and overexpressed sequence 2; Transmembrane protein 16A; TMEM16A; TAOS2; Oral cancer overexpressed protein 2; ORAOV2; Discovered on gastrointestinal stromal tumors protein 1; DOG1; Anoctamin1; Anoctamin-1 |
| Target Type |
Successful Target |
| Gene Name |
ANO1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-381-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uauacaagggcaagcucucugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-381 may function as a tumor suppressor by directly targeting ANO1 and regulating TGF-B pathway and EMT process in the development of progression of gastric cancer. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Calcium-dependent chloride channel anoctamin (ANO)
|
Target Info
|
|
|
Gap junction alpha-1 protein (GJA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-381 inhibits the metastasis of gastric cancer by targeting TMEM16A expression. J Exp Clin Cancer Res. 2017 Feb 13;36(1):29.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
