Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T04894 |
Target Info
|
| Target Name |
Liver and activation-regulated chemokine (CCL20) |
| Synonyms |
Smallinducible cytokine A20; Small-inducible cytokine A20; SCYA20; Macrophage inflammatory protein 3 alpha; MIP3alpha; MIP3A; MIP-3-alpha; Liver and activationregulated chemokine; LARC; CCL20(270); CC motif chemokine 20; CC chemokine LARC; C-C motif chemokine 20; Betachemokine exodus1; Beta-chemokine exodus-1 |
| Target Type |
Clinical trial Target |
| Gene Name |
CCL20 |
| Biochemical Class |
Cytokine: CC chemokine |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-21 suppresses gene expression through miR-21-binding sequences at the 3'UTR of CCL20 gene. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Immunohistochemistry; In Situ Hybridization; qRT-PCR |
[1] |
| 2 |
ELISA; Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-21 and its target gene CCL20 are both highly overexpressed in the microenvironment of colorectal tumors: significance of their regulation. Oncol Rep. 2013 Sep;30(3):1285-92.
|
| REF 2 |
MiR-21 is involved in cervical squamous cell tumorigenesis and regulates CCL20. Biochim Biophys Acta. 2012 Feb;1822(2):248-60.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
