Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T04393 Target Info
Target Name E3 ubiquitin protein ligase CBLB (CBLB)
Synonyms Signal transduction protein CBLB; Signal transduction protein CBL-B; SH3binding protein CBLB; SH3-binding protein CBL-B; RNF56; RING-type E3 ubiquitin transferase CBL-B; RING finger protein 56; Nbla00127; E3 ubiquitinprotein ligase CBLB; E3 ubiquitin-protein ligase CBL-B; Casitas Blineage lymphoma protooncogene b; Casitas B-lineage lymphoma proto-oncogene b
Target Type Literature-reported Target
Gene Name CBLB
Biochemical Class Acyltransferase
UniProt ID
Q13191
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-891b miRNA Info
miRNA Mature AC
MIMAT0004913
Sequence ugcaacuuaccugagucauuga
miRNA Species Homo sapiens
Regulation Mechanism miR-891b negatively regulates the expression of CBLB by directly targeting 3'UTR of the CBLB transcript. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA E3 ubiquitin protein ligase CBLB (CBLB) Target Info
CBLB_HUMAN
References  Top
REF 1 MicroRNA-891b is an independent prognostic factor of pancreatic cancer by targeting Cbl-b to suppress the growth of pancreatic cancer cells. Oncotarget. 2016 Dec 13;7(50):82338-82353.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.