miRNA General Information
miRNA Mature ID	hsa-miR-891b
miRNA Stemloop AC	MI0005534
miRNA Stemloop ID	hsa-mir-891b
Sequence	ugcaacuuaccugagucauuga
TTD Target(s) Regulated by This miRNA	E3 ubiquitin protein ligase CBLB (CBLB)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA-891b is an independent prognostic factor of pancreatic cancer by targeting Cbl-b to suppress the growth of pancreatic cancer cells. Oncotarget. 2016 Dec 13;7(50):82338-82353.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.