Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T02617 |
Target Info
|
| Target Name |
Transferrin (TF) |
| Synonyms |
Siderophilin; Serotransferrin; PRO1400; Beta-1 metal-binding globulin |
| Target Type |
Clinical trial Target |
| Gene Name |
TF |
| Biochemical Class |
Transferrin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugugcaaaucuaugcaaaacuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase reporter assay confirmed that TF was a direct target of miR- 19a. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Dual Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-19a contributes to the epigenetic regulation of tissue factor in diabetes. Cardiovasc Diabetol. 2018 Feb 24;17(1):34.
|
| REF 2 |
MicroRNA-19a targets tissue factor to inhibit colon cancer cells migration and invasion. Mol Cell Biochem. 2013 Aug;380(1-2):239-47.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
