Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T01597 |
Target Info
|
| Target Name |
Catalase (CAT) |
| Synonyms |
Human catalase |
| Target Type |
Clinical trial Target |
| Gene Name |
CAT |
| Biochemical Class |
Peroxide acceptor oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-30b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaaacauccuacacucagcu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The negative effect of miR-30b on catalase levels in the ARPE- 19 cell was the result of direct targeting of catalase mRNA by miR- 30b. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-30b-mediated regulation of catalase expression in human ARPE-19 cells. PLoS One. 2012;7(8):e42542.
|
| REF 2 |
MicroRNA-30b protects myocardial cell function in patients with acute myocardial ischemia by targeting plasminogen activator inhibitor-1. Exp Ther Med. 2018 Jun;15(6):5125-5132.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
