Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T01283 |
Target Info
|
| Target Name |
Tumor susceptibility gene protein 101 (TSG101) |
| Synonyms |
Tumor susceptibility gene 101 protein; ESCRT-I complex subunit TSG101 |
| Target Type |
Clinical trial Target |
| Gene Name |
TSG101 |
| Biochemical Class |
Ubiquitin-conjugating enzyme |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaaagugcuuauagugcagguag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
PAR-CLIP |
[1] |
| 2 |
Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
|
| REF 2 |
Identification of direct targets for the miR-17-92 cluster by proteomic analysis. Proteomics. 2011 Sep;11(17):3531-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
