Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00484 Target Info
Target Name Interleukin 23 receptor (IL23R)
Synonyms Interleukin-23 receptor; IL23 receptor; IL-23R; IL-23 receptor
Target Type Clinical trial Target
Gene Name IL23R
Biochemical Class Cytokine receptor
UniProt ID
Q5VWK5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Regulation Mechanism IL-23R is a functional target of miR-125a-3p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
References  Top
REF 1 Decreased expression of microRNA-125a-3p upregulates interleukin-23 receptor in patients with Hashimoto's thyroiditis. Immunol Res. 2015 Jun;62(2):129-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.