Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00477 Target Info
Target Name Serine Racemase (SRR)
Synonyms L-serine dehydratase; L-serine ammonia-lyase; D-serine dehydratase; D-serine ammonia-lyase
Target Type Literature-reported Target
Gene Name SRR
Biochemical Class Racemases and epimerase
UniProt ID
Q9GZT4
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-193a-5p miRNA Info
miRNA Mature AC
MIMAT0004614
Sequence ugggucuuugcgggcgagauga
miRNA Species Homo sapiens
Regulation Mechanism SRR is a direct target of miR-193a-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA AP-2 transcription factor (TFAP2A) Target Info
AP2A_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
References  Top
REF 1 MiR-193a-3p and miR-193a-5p suppress the metastasis of human osteosarcoma cells by down-regulating Rab27B and SRR, respectively. Clin Exp Metastasis. 2016 Apr;33(4):359-72.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.