miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-934 | ||||
| miRNA Stemloop AC | MI0005756 | ||||
| miRNA Stemloop ID | hsa-mir-934 | ||||
| Sequence | ugucuacuacuggagacacugg | ||||
| TTD Target(s) Regulated by This miRNA | Homeodomain interacting protein kinase 2 (HIPK2) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Histone-lysine N-methyltransferase 2C | Regulated Protein | [1] | ||
| Homeobox protein Hox-A4 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | Alcohol-dysregulated miR-30a and miR-934 in head and neck squamous cell carcinoma. Mol Cancer. 2015 Oct 15;14:181. | ||||
| REF 2 | Alcohol-dysregulated miR-30a and miR-934 in head and neck squamous cell carcinoma. Mol Cancer. 2015 Oct 15;14:181. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.